MultiQC Report

A modular tool to aggregate results from bioinformatics analyses across many samples into a single report.

JavaScript Disabled

MultiQC reports use JavaScript for plots and toolbox functions. It looks like you have JavaScript disabled in your web browser. Please note that many of the report functions will not work as intended.

Report generated on 2023-12-14, 17:16 PST based on data in:

/home/cmacdonald/NGS/gpr68_dec2022/results/gpr68_dec2022/gatk
/home/cmacdonald/NGS/gpr68_dec2022/stats/gpr68_dec2022/processing
/home/cmacdonald/NGS/gpr68_dec2022/stats/gpr68_dec2022/fastqc
/home/cmacdonald/NGS/gpr68_dec2022/stats/gpr68_dec2022

General Statistics

Showing ¹⁶⁶/₁₆₆ rows and ³/₆ columns.

Sample Name	% Dups	% GC	Average Read Length	Median Read Length	% Failed	M Seqs
Surface_26_S26_R1_001	95.3%	55%	250 bp	250 bp	45%	10.6
Surface_26_S26_R2_001	93.5%	55%	250 bp	250 bp	45%	10.6
Surface_27_S27_R1_001	96.2%	55%	250 bp	250 bp	36%	13.1
Surface_27_S27_R2_001	92.5%	55%	250 bp	250 bp	45%	13.1
Surface_28_S28_R1_001	96.7%	56%	250 bp	250 bp	36%	13.9
Surface_28_S28_R2_001	94.6%	55%	250 bp	250 bp	36%	13.9
Surface_29_S29_R1_001	95.6%	55%	250 bp	250 bp	45%	9.3
Surface_29_S29_R2_001	93.7%	55%	250 bp	250 bp	45%	9.3
Surface_55_S55_R1_001	96.0%	57%	250 bp	250 bp	36%	14.7
Surface_55_S55_R2_001	93.9%	56%	250 bp	250 bp	36%	14.7
Surface_56_S56_R1_001	95.8%	57%	250 bp	250 bp	36%	12.0
Surface_56_S56_R2_001	93.5%	58%	250 bp	250 bp	36%	12.0
Surface_57_S57_R1_001	95.9%	55%	250 bp	250 bp	45%	9.3
Surface_57_S57_R2_001	92.3%	56%	250 bp	250 bp	36%	9.3
Surface_58_S58_R1_001	96.3%	55%	250 bp	250 bp	45%	11.9
Surface_58_S58_R2_001	93.2%	55%	250 bp	250 bp	45%	11.9
Surface_81_S81_R1_001	94.5%	55%	250 bp	250 bp	36%	7.4
Surface_81_S81_R2_001	93.5%	55%	250 bp	250 bp	45%	7.4
Surface_82_S82_R1_001	95.7%	58%	250 bp	250 bp	36%	8.8
Surface_82_S82_R2_001	94.3%	58%	250 bp	250 bp	36%	8.8
Surface_83_S83_R1_001	95.7%	59%	250 bp	250 bp	36%	9.0
Surface_83_S83_R2_001	94.3%	60%	250 bp	250 bp	36%	9.0
nontreated_1_S1_R1_001	96.5%	56%	250 bp	250 bp	45%	19.6
nontreated_1_S1_R2_001	93.2%	56%	250 bp	250 bp	45%	19.6
nontreated_30_S30_R1_001	96.1%	56%	250 bp	250 bp	36%	13.8
nontreated_30_S30_R2_001	92.7%	56%	250 bp	250 bp	36%	13.8
pH55_2_S2_R1_001	95.4%	57%	250 bp	250 bp	36%	13.6
pH55_2_S2_R2_001	92.4%	56%	250 bp	250 bp	36%	13.6
pH55_31_S31_R1_001	95.9%	56%	250 bp	250 bp	36%	14.5
pH55_31_S31_R2_001	94.8%	57%	250 bp	250 bp	36%	14.5
pH55_32_S32_R1_001	96.1%	56%	250 bp	250 bp	36%	13.6
pH55_32_S32_R2_001	93.4%	57%	250 bp	250 bp	36%	13.6
pH55_33_S33_R1_001	95.8%	59%	250 bp	250 bp	36%	13.5
pH55_33_S33_R2_001	95.4%	58%	250 bp	250 bp	36%	13.5
pH55_34_S34_R1_001	96.6%	59%	250 bp	250 bp	36%	13.5
pH55_34_S34_R2_001	94.9%	57%	250 bp	250 bp	36%	13.5
pH55_3_S3_R1_001	96.2%	58%	250 bp	250 bp	36%	15.9
pH55_3_S3_R2_001	94.4%	57%	250 bp	250 bp	36%	15.9
pH55_4_S4_R1_001	96.0%	56%	250 bp	250 bp	45%	13.3
pH55_4_S4_R2_001	93.1%	55%	250 bp	250 bp	36%	13.3
pH55_59_S59_R1_001	96.4%	57%	250 bp	250 bp	36%	13.9
pH55_59_S59_R2_001	93.9%	56%	250 bp	250 bp	36%	13.9
pH55_5_S5_R1_001	96.1%	55%	250 bp	250 bp	45%	11.1
pH55_5_S5_R2_001	92.8%	55%	250 bp	250 bp	45%	11.1
pH55_60_S60_R1_001	96.2%	57%	250 bp	250 bp	36%	12.8
pH55_60_S60_R2_001	94.2%	57%	250 bp	250 bp	36%	12.8
pH55_61_S61_R1_001	96.4%	57%	250 bp	250 bp	36%	14.6
pH55_61_S61_R2_001	94.8%	57%	250 bp	250 bp	36%	14.6
pH55_62_S62_R1_001	93.2%	57%	250 bp	250 bp	36%	11.8
pH55_62_S62_R2_001	92.9%	56%	250 bp	250 bp	36%	11.8
pH55ogr_35_S35_R1_001	94.9%	56%	250 bp	250 bp	36%	10.4
pH55ogr_35_S35_R2_001	93.8%	55%	250 bp	250 bp	45%	10.4
pH55ogr_36_S36_R1_001	96.2%	57%	250 bp	250 bp	36%	14.2
pH55ogr_36_S36_R2_001	94.2%	56%	250 bp	250 bp	36%	14.2
pH55ogr_37_S37_R1_001	96.7%	58%	250 bp	250 bp	36%	15.5
pH55ogr_37_S37_R2_001	94.4%	57%	250 bp	250 bp	36%	15.5
pH55ogr_38_S38_R1_001	96.3%	56%	250 bp	250 bp	36%	12.0
pH55ogr_38_S38_R2_001	93.2%	56%	250 bp	250 bp	36%	12.0
pH55ogr_63_S63_R1_001	96.2%	58%	250 bp	250 bp	36%	14.3
pH55ogr_63_S63_R2_001	94.7%	58%	250 bp	250 bp	36%	14.3
pH55ogr_64_S64_R1_001	95.8%	56%	250 bp	250 bp	36%	16.9
pH55ogr_64_S64_R2_001	95.2%	57%	250 bp	250 bp	36%	16.9
pH55ogr_65_S65_R1_001	94.8%	56%	250 bp	250 bp	36%	7.2
pH55ogr_65_S65_R2_001	95.2%	56%	250 bp	250 bp	36%	7.2
pH55ogr_6_S6_R1_001	96.4%	56%	250 bp	250 bp	36%	19.6
pH55ogr_6_S6_R2_001	93.7%	56%	250 bp	250 bp	36%	19.6
pH55ogr_7_S7_R1_001	96.2%	56%	250 bp	250 bp	45%	12.9
pH55ogr_7_S7_R2_001	92.3%	56%	250 bp	250 bp	36%	12.9
pH55ogr_8_S8_R1_001	95.4%	55%	250 bp	250 bp	45%	11.5
pH55ogr_8_S8_R2_001	92.4%	55%	250 bp	250 bp	45%	11.5
pH55ogr_9_S9_R1_001	95.0%	57%	250 bp	250 bp	36%	8.8
pH55ogr_9_S9_R2_001	95.4%	57%	250 bp	250 bp	36%	8.8
pH65_18_S18_R1_001	94.4%	55%	250 bp	250 bp	45%	10.1
pH65_18_S18_R2_001	90.6%	55%	250 bp	250 bp	45%	10.1
pH65_19_S19_R1_001	96.2%	56%	250 bp	250 bp	45%	13.9
pH65_19_S19_R2_001	92.8%	55%	250 bp	250 bp	45%	13.9
pH65_20_S20_R1_001	95.7%	56%	250 bp	250 bp	36%	12.8
pH65_20_S20_R2_001	94.0%	56%	250 bp	250 bp	36%	12.8
pH65_21_S21_R1_001	89.2%	64%	250 bp	250 bp	36%	13.7
pH65_21_S21_R2_001	88.0%	64%	250 bp	250 bp	36%	13.7
pH65_47_S47_R1_001	96.1%	57%	250 bp	250 bp	36%	13.3
pH65_47_S47_R2_001	93.3%	56%	250 bp	250 bp	36%	13.3
pH65_48_S48_R1_001	96.5%	57%	250 bp	250 bp	36%	15.9
pH65_48_S48_R2_001	93.7%	57%	250 bp	250 bp	36%	15.9
pH65_49_S49_R1_001	96.5%	56%	250 bp	250 bp	36%	16.7
pH65_49_S49_R2_001	93.9%	56%	250 bp	250 bp	36%	16.7
pH65_50_S50_R1_001	90.9%	61%	250 bp	250 bp	36%	15.0
pH65_50_S50_R2_001	89.7%	60%	250 bp	250 bp	36%	15.0
pH65_73_S73_R1_001	94.3%	59%	250 bp	250 bp	36%	8.7
pH65_73_S73_R2_001	92.6%	58%	250 bp	250 bp	36%	8.7
pH65_74_S74_R1_001	94.4%	56%	250 bp	250 bp	36%	6.9
pH65_74_S74_R2_001	91.9%	56%	250 bp	250 bp	36%	6.9
pH65_75_S75_R1_001	95.1%	60%	250 bp	250 bp	36%	7.1
pH65_75_S75_R2_001	93.7%	59%	250 bp	250 bp	36%	7.1
pH65_76_S76_R1_001	88.7%	59%	250 bp	250 bp	36%	7.7
pH65_76_S76_R2_001	89.3%	59%	250 bp	250 bp	36%	7.7
pH65ogr_22_S22_R1_001	95.5%	55%	250 bp	250 bp	45%	9.8
pH65ogr_22_S22_R2_001	92.4%	55%	250 bp	250 bp	45%	9.8
pH65ogr_23_S23_R1_001	96.3%	57%	250 bp	250 bp	36%	12.9
pH65ogr_23_S23_R2_001	92.6%	57%	250 bp	250 bp	36%	12.9
pH65ogr_24_S24_R1_001	95.2%	57%	250 bp	250 bp	36%	10.9
pH65ogr_24_S24_R2_001	94.4%	57%	250 bp	250 bp	36%	10.9
pH65ogr_25_S25_R1_001	91.9%	60%	250 bp	250 bp	36%	13.1
pH65ogr_25_S25_R2_001	92.2%	59%	250 bp	250 bp	36%	13.1
pH65ogr_51_S51_R1_001	96.5%	57%	250 bp	250 bp	36%	15.2
pH65ogr_51_S51_R2_001	94.3%	56%	250 bp	250 bp	36%	15.2
pH65ogr_52_S52_R1_001	96.4%	56%	250 bp	250 bp	36%	12.6
pH65ogr_52_S52_R2_001	93.6%	56%	250 bp	250 bp	36%	12.6
pH65ogr_53_S53_R1_001	95.4%	56%	250 bp	250 bp	36%	11.1
pH65ogr_53_S53_R2_001	95.0%	57%	250 bp	250 bp	36%	11.1
pH65ogr_54_S54_R1_001	95.2%	56%	250 bp	250 bp	36%	15.3
pH65ogr_54_S54_R2_001	92.2%	57%	250 bp	250 bp	36%	15.3
pH65ogr_77_S77_R1_001	95.4%	55%	250 bp	250 bp	45%	6.7
pH65ogr_77_S77_R2_001	92.2%	55%	250 bp	250 bp	45%	6.7
pH65ogr_78_S78_R1_001	95.2%	56%	250 bp	250 bp	45%	7.3
pH65ogr_78_S78_R2_001	90.3%	56%	250 bp	250 bp	36%	7.3
pH65ogr_79_S79_R1_001	95.7%	56%	250 bp	250 bp	45%	8.5
pH65ogr_79_S79_R2_001	92.4%	56%	250 bp	250 bp	36%	8.5
pH65ogr_80_S80_R1_001	93.1%	57%	250 bp	250 bp	36%	7.2
pH65ogr_80_S80_R2_001	92.6%	57%	250 bp	250 bp	36%	7.2
pH6_10_S10_R1_001	95.3%	56%	250 bp	250 bp	45%	12.9
pH6_10_S10_R2_001	93.0%	56%	250 bp	250 bp	45%	12.9
pH6_11_S11_R1_001	95.2%	56%	250 bp	250 bp	45%	11.8
pH6_11_S11_R2_001	92.9%	56%	250 bp	250 bp	45%	11.8
pH6_12_S12_R1_001	96.1%	57%	250 bp	250 bp	45%	14.8
pH6_12_S12_R2_001	93.5%	56%	250 bp	250 bp	45%	14.8
pH6_13_S13_R1_001	92.3%	63%	250 bp	250 bp	36%	15.1
pH6_13_S13_R2_001	91.5%	61%	250 bp	250 bp	36%	15.1
pH6_39_S39_R1_001	96.4%	58%	250 bp	250 bp	36%	15.3
pH6_39_S39_R2_001	94.8%	57%	250 bp	250 bp	36%	15.3
pH6_40_S40_R1_001	96.3%	57%	250 bp	250 bp	36%	12.7
pH6_40_S40_R2_001	94.5%	56%	250 bp	250 bp	36%	12.7
pH6_41_S41_R1_001	95.1%	57%	250 bp	250 bp	36%	12.9
pH6_41_S41_R2_001	95.3%	56%	250 bp	250 bp	36%	12.9
pH6_42_S42_R1_001	93.6%	57%	250 bp	250 bp	36%	13.5
pH6_42_S42_R2_001	90.6%	57%	250 bp	250 bp	36%	13.5
pH6_66_S66_R1_001	95.6%	60%	250 bp	250 bp	36%	7.2
pH6_66_S66_R2_001	94.4%	59%	250 bp	250 bp	36%	7.2
pH6_67_S67_R1_001	95.4%	59%	250 bp	250 bp	36%	6.6
pH6_67_S67_R2_001	94.1%	58%	250 bp	250 bp	36%	6.6
pH6_68_S68_R1_001	95.2%	55%	250 bp	250 bp	45%	5.7
pH6_68_S68_R2_001	91.0%	55%	250 bp	250 bp	45%	5.7
pH6_69_S69_R1_001	94.8%	56%	250 bp	250 bp	36%	10.7
pH6_69_S69_R2_001	91.5%	56%	250 bp	250 bp	36%	10.7
pH6ogr_14_S14_R1_001	95.7%	55%	250 bp	250 bp	45%	12.3
pH6ogr_14_S14_R2_001	92.3%	56%	250 bp	250 bp	45%	12.3
pH6ogr_15_S15_R1_001	95.2%	56%	250 bp	250 bp	36%	12.3
pH6ogr_15_S15_R2_001	91.7%	56%	250 bp	250 bp	36%	12.3
pH6ogr_16_S16_R1_001	96.3%	56%	250 bp	250 bp	36%	14.0
pH6ogr_16_S16_R2_001	93.5%	56%	250 bp	250 bp	36%	14.0
pH6ogr_17_S17_R1_001	95.8%	55%	250 bp	250 bp	45%	10.0
pH6ogr_17_S17_R2_001	91.8%	56%	250 bp	250 bp	45%	10.0
pH6ogr_43_S43_R1_001	95.5%	57%	250 bp	250 bp	36%	12.8
pH6ogr_43_S43_R2_001	94.7%	57%	250 bp	250 bp	36%	12.8
pH6ogr_44_S44_R1_001	96.2%	57%	250 bp	250 bp	36%	12.3
pH6ogr_44_S44_R2_001	94.1%	56%	250 bp	250 bp	36%	12.3
pH6ogr_45_S45_R1_001	95.7%	56%	250 bp	250 bp	36%	10.9
pH6ogr_45_S45_R2_001	93.3%	56%	250 bp	250 bp	36%	10.9
pH6ogr_46_S46_R1_001	96.8%	57%	250 bp	250 bp	36%	12.9
pH6ogr_46_S46_R2_001	94.3%	56%	250 bp	250 bp	36%	12.9
pH6ogr_70_S70_R1_001	95.5%	56%	250 bp	250 bp	36%	7.6
pH6ogr_70_S70_R2_001	91.4%	56%	250 bp	250 bp	36%	7.6
pH6ogr_71_S71_R1_001	95.6%	57%	250 bp	250 bp	36%	8.3
pH6ogr_71_S71_R2_001	93.4%	56%	250 bp	250 bp	36%	8.3
pH6ogr_72_S72_R1_001	96.4%	56%	250 bp	250 bp	45%	7.9
pH6ogr_72_S72_R2_001	93.5%	56%	250 bp	250 bp	45%	7.9

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: general_stats_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC	% Dups	% Duplicate Reads	`percent_duplicates`	None
\|\|	FastQC	% GC	Average % GC Content	`percent_gc`	None
\|\|	FastQC	Average Read Length	Average Read Length (bp)	`avg_sequence_length`	None
\|\|	FastQC	Median Read Length	Median Read Length (bp)	`median_sequence_length`	None
\|\|	FastQC	% Failed	Percentage of modules failed in FastQC report (includes those not plotted here)	`percent_fails`	None
\|\|	FastQC	M Seqs	Total Sequences (millions)	`total_sequences`	read_count

Variant processing (accepted variants)

This section contains statistics about whether called variants were retained for analysis or not. By default, variants are filtered out if they are not in the designed variants csv.

Variant processing (rejected variants)

This section contains statistics about whether called variants were retained for analysis or not. By default, variants are filtered out if they are not in the designed variants csv.

Variant processing stats

This section contains statistics about whether called variants were retained for analysis or not. By default, variants are filtered out if they are not in the designed variants csv.

GATK

GATK is a toolkit offering a wide variety of tools with a primary focus on variant discovery and genotyping.DOI: 10.1101/201178; 10.1002/0471250953.bi1110s43; 10.1038/ng.806; 10.1101/gr.107524.110.

GATK ASM counts

Per-sample read count and base call fates from GATK AnalyzeSaturationMutagenesis.

This table shows the distribution of calls (for reads or for bases) across all samples. Reads are categorized as WT, a variant, or filtered. Bases can be either evaluated or unevaluated, corresponding to the reads they come from.

Reads are filtered for the following reasons:

Unmapped: the map quality is below the minimum MapQ (default = 4)'
Low quality reads: Reads are trimmed for quality > minQ (default 30) before calling variants. If the final size is less than the minimum length (default 15), or if the remaining segment does not cover the ORF, the read is filtered.

Paired reads are also split into overlapping and disjoint sets, with further filters for both.

Inconsistent: If overlapping reads disagree on the called variant, the read is filtered.
Ignored mate: If the pairs are disjoint, the first read of the pair is used for analysis, and the second is ignored.
Low quality variation: If the variant includes ambiguous bases (not A, C, G, or T, or -), the read is filtered.
Insufficient flank: If the variant does not include a certain number of WT bases (default 2) flanking the variant, the read is filtered.

Showing ⁸³/₈₃ rows and ⁴/₂₂ columns.

Sample Name	Total reads (M)	WT reads (M)	Variant reads (M)	Filtered reads (M)	Unmapped (M)	LowQ (M)	Evaluable (M)	Disjoint (M)	WT (disjoint) (M)	Called variants (disjoint) (M)	Mateless (M)	LowQ (disjoint) (M)	No flank (disjoint) (M)	Overlapping (M)	WT (overlapping) (M)	Called variants (overlapping) (M)	Low quality reads (overlapping) (M)	No flank (overlapping) (M)	Total bases (Mb)	Evaluated bases (Mb)	Unevaluated bases (Mb)
nontreated_R1	37.3	14.9	2.7	7.6	1.3	1.5	34.5	12.9	6.2	0.9	5.5	0.2	0.1	21.6	8.7	1.8	0.2	0.1	5069.6	2493.7	2575.9
nontreated_R2	26.5	10.5	1.8	6.2	1.0	1.3	24.2	10.3	5.0	0.7	4.4	0.2	0.1	13.9	5.6	1.1	0.2	0.1	3639.0	1727.0	1911.9
ph55_R1_B1	25.2	10.1	1.7	5.6	0.9	1.1	23.2	9.5	4.6	0.7	4.1	0.1	0.1	13.6	5.5	1.1	0.2	0.1	3437.2	1667.9	1769.3
ph55_R1_B2	29.4	12.0	2.0	5.0	0.9	0.8	27.7	8.7	4.2	0.6	3.7	0.1	0.0	19.0	7.8	1.4	0.2	0.1	3900.2	1965.2	1935.0
ph55_R1_B3	25.3	10.2	1.7	5.9	1.0	1.0	23.3	10.3	4.9	0.7	4.4	0.1	0.1	13.0	5.3	1.0	0.1	0.1	3486.7	1693.5	1793.3
ph55_R1_B4	21.0	8.6	1.3	5.8	0.9	1.0	19.1	10.2	5.0	0.6	4.5	0.1	0.0	8.9	3.7	0.6	0.1	0.0	2970.8	1413.2	1557.6
ph55_R2_B1	27.5	11.0	1.8	6.0	1.0	1.0	25.6	10.2	4.9	0.6	4.4	0.2	0.1	15.4	6.2	1.2	0.2	0.1	3765.9	1769.2	1996.7
ph55_R2_B2	26.0	10.4	1.8	5.4	1.0	1.0	24.0	9.1	4.4	0.7	3.9	0.1	0.1	14.8	6.0	1.2	0.2	0.1	3533.5	1732.4	1801.1
ph55_R2_B3	25.2	10.3	1.6	3.6	0.7	0.6	23.8	5.8	2.8	0.4	2.4	0.1	0.0	18.0	7.4	1.3	0.2	0.1	3228.4	1588.0	1640.4
ph55_R2_B4	25.3	10.5	1.5	4.0	0.8	0.7	23.8	6.8	3.3	0.4	2.9	0.1	0.0	17.0	7.1	1.1	0.2	0.1	3320.2	1668.3	1651.9
ph55_R3_B1	26.3	10.7	1.8	5.8	1.0	1.0	24.4	10.1	4.8	0.7	4.3	0.1	0.1	14.3	5.8	1.1	0.2	0.1	3594.9	1761.8	1833.1
ph55_R3_B2	24.2	9.8	1.6	4.7	0.8	0.9	22.5	8.0	3.9	0.5	3.4	0.1	0.0	14.5	5.9	1.1	0.2	0.1	3255.9	1588.6	1667.3
ph55_R3_B3	27.5	11.3	1.8	4.9	0.9	0.8	25.8	8.6	4.2	0.6	3.7	0.1	0.0	17.1	7.1	1.2	0.2	0.1	3638.0	1826.3	1811.7
ph55_R3_B4	21.3	8.8	1.2	4.6	0.8	0.7	19.8	7.9	3.8	0.4	3.4	0.2	0.0	11.9	5.0	0.8	0.2	0.0	2909.4	1358.2	1551.3
ph55_ogr_R1_B1	37.1	14.8	2.6	8.0	1.3	1.5	34.4	13.5	6.5	0.9	5.8	0.2	0.1	20.8	8.4	1.7	0.2	0.1	5058.2	2461.3	2596.9
ph55_ogr_R1_B2	24.6	9.8	1.7	6.1	1.0	1.2	22.4	10.4	5.0	0.7	4.4	0.2	0.1	12.0	4.8	1.0	0.1	0.1	3418.2	1634.6	1783.6
ph55_ogr_R1_B3	22.1	8.7	1.5	5.9	0.9	1.2	20.0	9.8	4.7	0.6	4.2	0.2	0.1	10.2	4.0	0.8	0.1	0.1	3092.6	1398.2	1694.3
ph55_ogr_R1_B4	16.6	6.8	1.0	2.8	0.5	0.5	15.6	4.6	2.3	0.3	1.9	0.1	0.0	11.0	4.6	0.7	0.2	0.0	2208.6	1054.8	1153.8
ph55_ogr_R2_B1	20.0	7.9	1.3	5.0	0.8	0.9	18.3	8.3	4.0	0.5	3.6	0.3	0.0	10.0	3.9	0.8	0.2	0.1	2770.3	1218.1	1552.2
ph55_ogr_R2_B2	26.9	10.8	1.9	5.4	1.0	0.9	25.0	9.3	4.5	0.7	4.0	0.1	0.1	15.7	6.3	1.2	0.2	0.1	3641.9	1794.4	1847.4
ph55_ogr_R2_B3	29.5	12.0	2.0	5.3	1.0	1.0	27.6	9.1	4.4	0.6	3.9	0.1	0.0	18.5	7.6	1.3	0.2	0.1	3908.0	1948.2	1959.8
ph55_ogr_R2_B4	23.2	9.3	1.5	5.8	0.9	1.1	21.2	10.0	4.8	0.7	4.3	0.2	0.0	11.2	4.5	0.9	0.1	0.1	3217.4	1536.3	1681.0
ph55_ogr_R3_B1	26.8	10.9	1.8	4.4	0.9	0.8	25.1	7.4	3.6	0.5	3.1	0.1	0.0	17.7	7.3	1.3	0.2	0.1	3527.4	1758.0	1769.4
ph55_ogr_R3_B2	32.0	12.8	2.0	7.3	1.2	1.2	29.6	12.5	5.9	0.8	5.4	0.3	0.1	17.1	6.9	1.3	0.3	0.1	4405.2	2049.5	2355.7
ph55_ogr_R3_B4	13.8	5.7	0.8	3.1	0.5	0.5	12.8	5.3	2.6	0.3	2.3	0.2	0.0	7.6	3.1	0.5	0.1	0.0	1886.3	851.8	1034.4
ph65_R1_B1	19.5	7.6	1.1	6.5	0.8	1.5	17.2	10.3	4.9	0.6	4.4	0.4	0.1	6.9	2.7	0.6	0.1	0.0	2789.6	1110.9	1678.7
ph65_R1_B2	26.8	10.7	1.8	7.0	1.1	1.3	24.4	12.0	5.8	0.8	5.2	0.2	0.1	12.4	4.9	1.0	0.1	0.1	3758.0	1781.1	1976.9
ph65_R1_B3	24.4	9.8	1.6	6.0	0.9	1.0	22.5	10.3	4.9	0.6	4.5	0.2	0.1	12.2	4.9	0.9	0.2	0.1	3381.6	1582.0	1799.6
ph65_R1_B4	13.9	5.9	0.8	0.8	0.2	0.2	13.5	1.0	0.5	0.1	0.4	0.0	0.0	12.5	5.4	0.7	0.1	0.1	1515.1	763.4	751.6
ph65_R2_B1	25.2	10.2	1.7	5.3	0.9	1.0	23.4	9.1	4.4	0.6	3.9	0.1	0.0	14.3	5.8	1.1	0.2	0.1	3417.1	1670.3	1746.7
ph65_R2_B2	30.4	12.2	2.1	6.2	1.1	1.1	28.2	10.7	5.2	0.7	4.6	0.1	0.1	17.5	7.1	1.4	0.2	0.1	4102.0	2027.8	2074.2
ph65_R2_B3	31.8	12.8	2.2	7.0	1.1	1.2	29.5	12.0	5.8	0.8	5.2	0.2	0.1	17.5	7.0	1.4	0.2	0.1	4354.6	2109.2	2245.4
ph65_R2_B4	14.9	6.2	0.9	2.0	0.4	0.3	14.2	3.3	1.6	0.2	1.4	0.1	0.0	10.9	4.6	0.7	0.1	0.0	1872.7	943.8	928.9
ph65_R3_B1	14.5	6.0	0.9	2.1	0.4	0.4	13.7	3.6	1.7	0.3	1.5	0.0	0.0	10.1	4.2	0.7	0.1	0.0	1853.2	934.1	919.1
ph65_R3_B2	12.3	5.0	0.8	2.9	0.5	0.5	11.3	5.0	2.4	0.3	2.2	0.1	0.0	6.3	2.6	0.5	0.1	0.0	1712.6	822.8	889.8
ph65_R3_B3	12.5	5.2	0.8	1.5	0.3	0.3	11.9	2.5	1.2	0.2	1.0	0.0	0.0	9.4	3.9	0.6	0.1	0.0	1578.9	807.6	771.3
ph65_R3_B4	8.7	3.6	0.5	1.4	0.3	0.3	8.2	2.4	1.2	0.1	1.0	0.1	0.0	5.8	2.4	0.4	0.1	0.0	1129.9	535.6	594.3
ph65_ogr_R1_B1	18.7	7.4	1.3	4.8	0.8	0.9	17.0	8.3	4.0	0.6	3.6	0.1	0.0	8.7	3.5	0.7	0.1	0.0	2610.5	1236.1	1374.4
ph65_ogr_R1_B2	24.4	9.8	1.6	4.7	0.8	1.1	22.5	7.8	3.8	0.5	3.2	0.1	0.0	14.8	6.0	1.1	0.2	0.1	3269.7	1597.9	1671.8
ph65_ogr_R1_B3	20.7	8.4	1.3	3.9	0.7	0.7	19.3	6.3	3.1	0.4	2.7	0.2	0.0	12.9	5.3	0.9	0.2	0.1	2777.1	1311.1	1466.0
ph65_ogr_R1_B4	18.0	7.5	1.0	2.4	0.5	0.5	17.0	3.8	1.9	0.2	1.6	0.1	0.0	13.2	5.6	0.8	0.2	0.0	2267.6	1107.1	1160.4
ph65_ogr_R2_B1	28.8	11.7	2.0	5.7	1.0	0.9	26.9	10.0	4.8	0.7	4.3	0.1	0.1	16.9	6.9	1.3	0.2	0.1	3873.8	1919.6	1954.1
ph65_ogr_R2_B2	24.3	9.7	1.7	5.5	0.9	1.0	22.4	9.4	4.5	0.6	4.1	0.1	0.0	13.0	5.2	1.0	0.2	0.1	3365.9	1649.2	1716.6
ph65_ogr_R2_B3	21.3	8.6	1.3	4.9	0.8	0.8	19.8	8.2	4.0	0.5	3.5	0.2	0.0	11.5	4.7	0.8	0.2	0.1	2920.9	1326.8	1594.1
ph65_ogr_R2_B4	24.5	10.2	1.4	5.5	0.9	0.9	22.7	9.8	4.8	0.6	4.2	0.1	0.0	12.9	5.4	0.8	0.1	0.0	3372.8	1671.3	1701.5
ph65_ogr_R3_B1	13.0	5.2	0.9	3.6	0.6	0.6	11.8	6.2	3.0	0.4	2.7	0.1	0.0	5.6	2.3	0.4	0.1	0.0	1839.3	863.5	975.8
ph65_ogr_R3_B2	14.0	5.6	0.9	3.6	0.6	0.8	12.5	5.9	2.9	0.4	2.5	0.1	0.0	6.6	2.7	0.5	0.1	0.0	1947.7	904.5	1043.3
ph65_ogr_R3_B3	16.3	6.6	1.1	3.8	0.6	0.7	14.9	6.6	3.2	0.4	2.8	0.1	0.0	8.4	3.4	0.6	0.1	0.0	2254.5	1076.4	1178.1
ph65_ogr_R3_B4	11.3	4.7	0.6	2.0	0.4	0.3	10.6	3.4	1.7	0.2	1.4	0.1	0.0	7.2	3.0	0.5	0.1	0.0	1514.0	725.8	788.2
ph6_R1_B1	24.6	9.8	1.6	6.3	0.9	1.3	22.4	10.4	5.0	0.6	4.5	0.3	0.1	12.0	4.8	1.0	0.2	0.1	3419.2	1525.4	1893.8
ph6_R1_B2	22.5	8.9	1.6	5.3	0.9	1.0	20.6	8.7	4.2	0.6	3.7	0.2	0.0	11.9	4.7	1.0	0.2	0.1	3101.2	1448.1	1653.1
ph6_R1_B3	28.1	11.3	1.9	6.0	1.0	1.1	26.1	10.4	5.0	0.7	4.5	0.2	0.1	15.7	6.3	1.2	0.2	0.1	3824.8	1864.6	1960.2
ph6_R1_B4	20.0	8.4	1.1	1.7	0.4	0.4	19.2	2.5	1.3	0.1	1.0	0.1	0.0	16.8	7.2	1.0	0.2	0.1	2377.4	1187.4	1189.9
ph6_R2_B1	28.8	11.7	1.9	4.8	0.9	0.8	27.1	8.1	3.9	0.5	3.5	0.1	0.0	18.9	7.8	1.4	0.2	0.1	3778.6	1887.4	1891.2
ph6_R2_B2	24.1	9.7	1.7	4.8	0.8	0.7	22.5	8.5	4.1	0.6	3.7	0.1	0.0	14.0	5.7	1.1	0.1	0.1	3275.7	1632.9	1642.8
ph6_R2_B3	24.4	9.8	1.4	5.2	0.8	0.9	22.7	8.6	4.1	0.4	3.6	0.3	0.0	14.1	5.7	1.0	0.2	0.1	3289.2	1457.3	1831.9
ph6_R2_B4	17.9	7.5	1.1	3.8	0.6	0.7	16.7	6.7	3.3	0.4	2.9	0.1	0.0	9.9	4.2	0.6	0.1	0.0	2430.0	1198.4	1231.6
ph6_R3_B1	13.1	5.4	0.8	1.4	0.3	0.3	12.5	2.2	1.1	0.2	0.9	0.0	0.0	10.3	4.3	0.7	0.1	0.0	1618.6	826.1	792.5
ph6_R3_B2	12.0	5.0	0.8	1.6	0.3	0.2	11.4	2.7	1.3	0.2	1.2	0.0	0.0	8.7	3.6	0.6	0.1	0.0	1524.7	783.4	741.2
ph6_R3_B3	11.1	4.5	0.7	3.4	0.5	0.6	10.0	6.0	2.9	0.4	2.6	0.1	0.0	4.0	1.6	0.3	0.0	0.0	1584.0	731.7	852.3
ph6_R3_B4	19.0	7.6	1.3	4.6	0.8	0.9	17.4	8.0	3.8	0.5	3.4	0.1	0.0	9.4	3.8	0.8	0.1	0.1	2641.1	1279.9	1361.2
ph6_ogr_R1_B1	23.5	9.4	1.6	6.3	0.9	1.2	21.4	10.8	5.2	0.8	4.7	0.2	0.1	10.6	4.2	0.9	0.1	0.1	3292.8	1557.4	1735.4
ph6_ogr_R1_B2	23.4	9.2	1.5	5.9	0.9	1.4	21.1	9.4	4.6	0.6	3.9	0.2	0.1	11.8	4.7	0.9	0.2	0.1	3238.9	1444.1	1794.8
ph6_ogr_R1_B3	26.7	10.8	1.9	5.8	1.0	1.0	24.8	10.2	4.9	0.7	4.4	0.1	0.1	14.6	5.9	1.2	0.2	0.1	3665.7	1816.2	1849.5
ph6_ogr_R1_B4	18.8	7.7	1.1	5.1	0.8	1.0	17.1	9.0	4.4	0.5	3.9	0.1	0.0	8.0	3.3	0.6	0.1	0.0	2650.8	1264.3	1386.5
ph6_ogr_R2_B1	24.3	9.8	1.6	4.8	0.8	0.9	22.7	8.0	3.8	0.5	3.4	0.2	0.0	14.7	5.9	1.1	0.2	0.1	3258.4	1528.6	1729.8
ph6_ogr_R2_B2	23.4	9.4	1.7	4.6	0.8	0.7	21.8	8.2	3.9	0.6	3.5	0.1	0.0	13.6	5.4	1.1	0.1	0.1	3181.3	1594.3	1587.1
ph6_ogr_R2_B3	20.9	8.3	1.4	5.2	0.8	0.9	19.1	8.7	4.2	0.5	3.8	0.2	0.0	10.4	4.1	0.8	0.1	0.1	2880.2	1325.8	1554.4
ph6_ogr_R2_B4	24.4	10.1	1.5	5.1	0.9	0.9	22.7	8.9	4.4	0.5	3.8	0.1	0.0	13.8	5.8	0.9	0.1	0.1	3309.5	1634.7	1674.8
ph6_ogr_R3_B1	14.6	5.8	1.0	3.7	0.6	0.7	13.2	6.3	3.0	0.4	2.7	0.1	0.0	6.9	2.8	0.5	0.1	0.0	2025.9	966.2	1059.7
ph6_ogr_R3_B3	15.7	6.4	1.0	3.4	0.6	0.6	14.5	5.9	2.8	0.4	2.5	0.1	0.0	8.7	3.6	0.6	0.1	0.0	2137.3	1040.1	1097.2
ph6_ogr_R3_B4	15.2	6.3	0.9	3.5	0.6	0.6	14.0	6.2	3.0	0.4	2.7	0.1	0.0	7.8	3.3	0.5	0.1	0.0	2101.3	1017.8	1083.5
surface_R1_B1	20.3	8.0	1.4	5.7	0.8	0.9	18.6	9.8	4.6	0.6	4.3	0.2	0.1	8.8	3.4	0.8	0.1	0.1	2876.9	1318.0	1558.9
surface_R1_B2	25.3	10.0	1.8	6.8	1.1	1.3	22.9	11.7	5.6	0.8	5.0	0.2	0.1	11.2	4.4	0.9	0.1	0.1	3570.5	1695.5	1875.0
surface_R1_B3	26.8	10.9	1.7	6.4	1.0	1.0	24.8	11.3	5.4	0.7	4.9	0.2	0.1	13.5	5.5	1.0	0.2	0.1	3723.7	1811.1	1912.5
surface_R1_B4	17.7	7.2	1.0	5.2	0.7	0.9	16.1	9.0	4.3	0.5	3.9	0.2	0.0	7.1	2.9	0.5	0.1	0.0	2511.9	1109.8	1402.1
surface_R2_B1	27.7	11.1	1.9	5.7	1.0	1.0	25.7	9.7	4.7	0.7	4.2	0.2	0.1	15.9	6.5	1.2	0.2	0.1	3750.6	1825.0	1925.6
surface_R2_B2	22.8	9.1	1.6	4.3	0.8	0.9	21.1	7.2	3.5	0.5	3.1	0.1	0.0	13.9	5.6	1.1	0.2	0.1	3070.3	1517.6	1552.7
surface_R2_B3	17.8	7.2	1.2	4.7	0.8	0.9	16.2	8.2	4.0	0.5	3.5	0.1	0.0	8.0	3.2	0.6	0.1	0.0	2493.9	1187.4	1306.5
surface_R2_B4	22.8	9.2	1.4	6.4	0.9	1.2	20.7	10.9	5.3	0.7	4.7	0.2	0.0	9.8	4.0	0.8	0.1	0.0	3217.2	1486.2	1731.0
surface_R3_B1	14.2	5.6	0.9	3.6	0.6	0.6	13.0	6.1	2.9	0.4	2.7	0.2	0.0	6.8	2.7	0.5	0.1	0.0	1974.5	888.4	1086.2
surface_R3_B2	16.4	6.7	1.1	2.5	0.5	0.5	15.5	4.3	2.1	0.3	1.8	0.1	0.0	11.2	4.6	0.8	0.1	0.0	2146.1	1085.2	1060.9
surface_R3_B4	16.5	6.8	1.0	2.1	0.5	0.4	15.6	3.4	1.7	0.2	1.4	0.1	0.0	12.2	5.2	0.8	0.1	0.0	2063.8	1033.0	1030.8

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: gatk_ask_stats

Sort	Group	Column	Description	ID	Scale
\|\|	GATK	Total reads (M)	Total reads in sample (millions)	`gatk_ask_total_reads`	read_count
\|\|	GATK	WT reads (M)	Total evaluated reads mapped to WT (millions)	`gatk_ask_wt_total_reads`	read_count
\|\|	GATK	Variant reads (M)	Reads with a variant called (millions)	`gatk_ask_variants_total_reads`	read_count
\|\|	GATK	Filtered reads (M)	Reads filtered from sample (millions)	`gatk_ask_filtered_reads`	read_count
\|\|	GATK	Unmapped (M)	Unmapped reads in sample (millions)	`gatk_ask_unmapped_reads`	read_count
\|\|	GATK	LowQ (M)	Low quality reads in sample (millions)	`gatk_ask_lowq_reads`	read_count
\|\|	GATK	Evaluable (M)	Evaluable reads in sample (millions)	`gatk_ask_evaluable_reads`	read_count
\|\|	GATK	Disjoint (M)	Reads from disjoint (non-overlapping) paired-end reads in sample (millions)	`gatk_ask_disjoint_pairs`	read_count
\|\|	GATK	WT (disjoint) (M)	WT reads called from disjoint pairs (millions)	`gatk_ask_wt_reads_disjoint`	disjoint_read_count
\|\|	GATK	Called variants (disjoint) (M)	Reads with variants called from disjoint pairs (millions)	`gatk_ask_called_variants_disjoint`	disjoint_read_count
\|\|	GATK	Mateless (M)	Reads with ignored mates called from disjoint pairs (millions)	`gatk_ask_mate_ignored_disjoint`	disjoint_read_count
\|\|	GATK	LowQ (disjoint) (M)	Reads with low quality variation from disjoint pairs (millions)	`gatk_ask_low_quality_variation_disjoint`	disjoint_read_count
\|\|	GATK	No flank (disjoint) (M)	Reads with insufficient flank from disjoint pairs (millions)	`gatk_ask_insufficient_flank_disjoint`	disjoint_read_count
\|\|	GATK	Overlapping (M)	Reads from overlapping paired-end reads in sample (millions)	`gatk_ask_overlapping_pairs`	overlapping_read_count
\|\|	GATK	WT (overlapping) (M)	WT reads called from overlapping pairs (millions)	`gatk_ask_wt_reads_overlapping`	overlapping_read_count
\|\|	GATK	Called variants (overlapping) (M)	Reads with variants called from overlapping pairs (millions)	`gatk_ask_called_variants_overlapping`	overlapping_read_count
\|\|	GATK	Inconsistent (overlapping) (M)	Reads with inconsistent pairs from overlapping pairs (millions)	`gatk_ask_inconsistent_overlapping`	overlapping_read_count
\|\|	GATK	Low quality reads (overlapping) (M)	Reads with low quality variation from overlapping pairs (millions)	`gatk_ask_low_quality_variation_overlapping`	overlapping_read_count
\|\|	GATK	No flank (overlapping) (M)	Reads with insufficient flank from overlapping pairs (millions)	`gatk_ask_insufficient_flank_overlapping`	overlapping_read_count
\|\|	GATK	Total bases (Mb)	Total base calls in sample (millions)	`gatk_ask_total_base_calls`	base_calls
\|\|	GATK	Evaluated bases (Mb)	Evaluated base calls in sample (millions)	`gatk_ask_evaluated_base_calls`	base_calls
\|\|	GATK	Unevaluated bases (Mb)	Unevaluated base calls in sample (millions)	`gatk_ask_unevaluated_base_calls`	base_calls

Read counts

Read counts and read fate. Filtered reads include unmapped, low quality, and other pathologies.

Reads can be filtered by GATK AnalyzeSaturationMutagenesis for a number of reasons, including low quality, insufficient flank, and other pathologies. This plot shows the number of reads that were mapped to WT, called as variants, and the number that were filtered.

Base calls

Base calls evaluated for variants and base calls not evaluated for variants.

Bases can be filtered by GATK AnalyzeSaturationMutagenesis for a number of reasons, including low quality, insufficient flank, and other pathologies. This plot shows the number of base calls that were evaluated for variants and the number of base calls that were not evaluated for variants.

BBTools

BBTools is a suite of fast multithreaded bioinformatics tools designed for the analysis of DNA and RNA sequence data.

BBDuk filtering statistics summary table

Proportion of reads that matched adapters/contaminants.

Showing ⁸³/₈₃ rows and ¹/₃ columns.

Sample Name	Total	Matched	Percent filtered
nontreated_R1	39.1	0.0	0.0%
nontreated_R2	27.6	6.4	23.0%
ph55_R1_B1	27.1	6.8	25.0%
ph55_R1_B2	31.7	0.0	0.0%
ph55_R1_B3	26.6	6.1	22.9%
ph55_R1_B4	22.3	3.8	16.8%
ph55_R2_B1	28.9	7.2	24.8%
ph55_R2_B2	27.3	0.0	0.0%
ph55_R2_B3	27.0	10.2	37.9%
ph55_R2_B4	27.0	9.0	33.4%
ph55_R3_B1	27.7	0.0	0.0%
ph55_R3_B2	25.7	0.0	0.0%
ph55_R3_B3	29.2	0.0	0.0%
ph55_R3_B4	23.5	0.0	0.0%
ph55_ogr_R1_B1	39.2	0.0	0.0%
ph55_ogr_R1_B2	25.7	5.5	21.4%
ph55_ogr_R1_B3	23.0	4.4	19.1%
ph55_ogr_R1_B4	17.6	5.6	31.6%
ph55_ogr_R2_B1	20.9	4.5	21.6%
ph55_ogr_R2_B2	28.4	0.0	0.0%
ph55_ogr_R2_B3	31.0	9.7	31.4%
ph55_ogr_R2_B4	24.0	4.9	20.5%
ph55_ogr_R3_B1	28.6	9.3	32.7%
ph55_ogr_R3_B2	33.9	0.0	0.0%
ph55_ogr_R3_B4	14.5	3.6	24.7%
ph65_R1_B1	20.3	2.8	14.0%
ph65_R1_B2	27.8	5.3	18.9%
ph65_R1_B3	25.6	5.6	21.8%
ph65_R1_B4	27.5	17.8	64.9%
ph65_R2_B1	26.5	7.0	26.5%
ph65_R2_B2	31.8	8.6	27.0%
ph65_R2_B3	33.4	8.2	24.6%
ph65_R2_B4	30.0	13.1	43.8%
ph65_R3_B1	17.5	6.9	39.3%
ph65_R3_B2	13.8	0.0	0.0%
ph65_R3_B3	14.2	0.0	0.0%
ph65_R3_B4	15.4	5.8	37.6%
ph65_ogr_R1_B1	19.5	3.8	19.5%
ph65_ogr_R1_B2	25.7	0.0	0.0%
ph65_ogr_R1_B3	21.8	6.4	29.2%
ph65_ogr_R1_B4	26.1	0.0	0.0%
ph65_ogr_R2_B1	30.4	8.6	28.3%
ph65_ogr_R2_B2	25.3	0.0	0.0%
ph65_ogr_R2_B3	22.3	5.3	24.0%
ph65_ogr_R2_B4	30.7	7.2	23.4%
ph65_ogr_R3_B1	13.5	2.3	16.8%
ph65_ogr_R3_B2	14.5	0.0	0.0%
ph65_ogr_R3_B3	17.1	3.8	22.4%
ph65_ogr_R3_B4	14.3	4.3	29.9%
ph6_R1_B1	25.7	5.4	21.1%
ph6_R1_B2	23.6	0.0	0.0%
ph6_R1_B3	29.6	7.6	25.8%
ph6_R1_B4	30.3	16.2	53.6%
ph6_R2_B1	30.6	10.2	33.4%
ph6_R2_B2	25.3	6.7	26.3%
ph6_R2_B3	25.7	7.1	27.6%
ph6_R2_B4	27.0	7.5	27.8%
ph6_R3_B1	14.3	6.4	44.8%
ph6_R3_B2	13.1	5.2	39.4%
ph6_R3_B3	11.5	1.6	14.3%
ph6_R3_B4	21.4	4.4	20.5%
ph6_ogr_R1_B1	24.6	4.6	18.9%
ph6_ogr_R1_B2	24.5	5.5	22.4%
ph6_ogr_R1_B3	28.0	6.7	24.1%
ph6_ogr_R1_B4	20.0	3.5	17.6%
ph6_ogr_R2_B1	25.6	0.0	0.0%
ph6_ogr_R2_B2	24.6	6.4	25.9%
ph6_ogr_R2_B3	21.7	0.0	0.0%
ph6_ogr_R2_B4	25.7	0.0	0.0%
ph6_ogr_R3_B1	15.2	3.1	20.3%
ph6_ogr_R3_B3	16.6	4.2	25.6%
ph6_ogr_R3_B4	15.9	3.6	22.4%
surface_R1_B1	21.1	3.4	16.3%
surface_R1_B2	26.2	4.5	17.3%
surface_R1_B3	27.9	0.0	0.0%
surface_R1_B4	18.6	0.0	0.0%
surface_R2_B1	29.4	7.9	26.9%
surface_R2_B2	24.0	0.0	0.0%
surface_R2_B3	18.5	3.5	18.9%
surface_R2_B4	23.8	4.1	17.2%
surface_R3_B1	14.8	3.0	20.0%
surface_R3_B2	17.6	6.1	34.5%
surface_R3_B4	18.0	7.5	41.7%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: stats_bbm_table

Sort	Group	Column	Description	ID	Scale
\|\|	BBTools	Total	Aligned Reads (millions)	`Total`	read_count
\|\|	BBTools	Matched	Aligned Reads (millions)	`Matched`	read_count
\|\|	BBTools	Percent filtered	Proportion of reads filtered, matching adapters/contaminants	`Percent filtered`	None

Identity histogram

Histogram of read count versus percent base pair identity of aligned reads (idhist).

Identity histogram summary table

Histogram of read count versus percent base pair identity of aligned reads (idhist).

Showing ⁸³/₈₃ rows and ⁸/₈ columns.

Sample Name	Mean_reads	Mean_bases	Median_reads	Median_bases	Mode_reads	Mode_bases	STDev_reads	STDev_bases
nontreated_R1	97.4	97.3	100.0	100.0	100.0	100.0	7.5	7.5
nontreated_R2	97.4	97.3	100.0	100.0	100.0	100.0	7.4	7.5
ph55_R1_B1	97.3	97.2	100.0	100.0	100.0	100.0	7.7	7.8
ph55_R1_B2	97.3	97.2	100.0	100.0	100.0	100.0	7.8	7.9
ph55_R1_B3	97.5	97.4	100.0	100.0	100.0	100.0	7.3	7.4
ph55_R1_B4	97.8	97.8	100.0	100.0	100.0	100.0	6.7	6.8
ph55_R2_B1	97.4	97.3	100.0	100.0	100.0	100.0	7.6	7.7
ph55_R2_B2	97.3	97.2	100.0	100.0	100.0	100.0	7.8	7.9
ph55_R2_B3	97.4	97.2	100.0	100.0	100.0	100.0	7.7	7.8
ph55_R2_B4	97.8	97.7	100.0	100.0	100.0	100.0	6.8	7.0
ph55_R3_B1	97.3	97.2	100.0	100.0	100.0	100.0	7.7	7.8
ph55_R3_B2	97.3	97.2	100.0	100.0	100.0	100.0	7.7	7.8
ph55_R3_B3	97.5	97.4	100.0	100.0	100.0	100.0	7.6	7.7
ph55_R3_B4	97.7	97.7	100.0	100.0	100.0	100.0	6.9	7.0
ph55_ogr_R1_B1	97.3	97.2	100.0	100.0	100.0	100.0	7.8	7.8
ph55_ogr_R1_B2	97.2	97.1	100.0	100.0	100.0	100.0	7.9	7.9
ph55_ogr_R1_B3	97.4	97.3	100.0	100.0	100.0	100.0	7.4	7.5
ph55_ogr_R1_B4	97.7	97.6	100.0	100.0	100.0	100.0	7.0	7.1
ph55_ogr_R2_B1	97.2	97.1	100.0	100.0	100.0	100.0	7.8	7.9
ph55_ogr_R2_B2	97.2	97.1	100.0	100.0	100.0	100.0	7.9	8.0
ph55_ogr_R2_B3	97.4	97.2	100.0	100.0	100.0	100.0	7.7	7.8
ph55_ogr_R2_B4	97.7	97.6	100.0	100.0	100.0	100.0	6.8	6.9
ph55_ogr_R3_B1	97.3	97.2	100.0	100.0	100.0	100.0	7.8	7.9
ph55_ogr_R3_B2	97.2	97.2	100.0	100.0	100.0	100.0	7.8	7.9
ph55_ogr_R3_B4	97.8	97.7	100.0	100.0	100.0	100.0	6.8	6.9
ph65_R1_B1	97.3	97.3	100.0	100.0	100.0	100.0	7.3	7.3
ph65_R1_B2	97.4	97.3	100.0	100.0	100.0	100.0	7.5	7.5
ph65_R1_B3	97.4	97.3	100.0	100.0	100.0	100.0	7.6	7.7
ph65_R1_B4	97.5	97.2	100.0	100.0	100.0	100.0	7.7	8.0
ph65_R2_B1	97.4	97.4	100.0	100.0	100.0	100.0	7.4	7.5
ph65_R2_B2	97.5	97.4	100.0	100.0	100.0	100.0	7.4	7.5
ph65_R2_B3	97.4	97.3	100.0	100.0	100.0	100.0	7.6	7.7
ph65_R2_B4	97.5	97.3	100.0	100.0	100.0	100.0	7.6	7.7
ph65_R3_B1	97.5	97.4	100.0	100.0	100.0	100.0	7.4	7.6
ph65_R3_B2	97.4	97.4	100.0	100.0	100.0	100.0	7.5	7.5
ph65_R3_B3	97.5	97.3	100.0	100.0	100.0	100.0	7.6	7.7
ph65_R3_B4	97.3	97.2	100.0	100.0	100.0	100.0	7.7	7.9
ph65_ogr_R1_B1	97.4	97.3	100.0	100.0	100.0	100.0	7.5	7.6
ph65_ogr_R1_B2	97.4	97.3	100.0	100.0	100.0	100.0	7.5	7.6
ph65_ogr_R1_B3	97.5	97.4	100.0	100.0	100.0	100.0	7.3	7.4
ph65_ogr_R1_B4	97.8	97.6	100.0	100.0	100.0	100.0	6.9	7.1
ph65_ogr_R2_B1	97.4	97.3	100.0	100.0	100.0	100.0	7.5	7.6
ph65_ogr_R2_B2	97.3	97.3	100.0	100.0	100.0	100.0	7.6	7.7
ph65_ogr_R2_B3	97.4	97.4	100.0	100.0	100.0	100.0	7.5	7.6
ph65_ogr_R2_B4	97.8	97.7	100.0	100.0	100.0	100.0	6.9	7.0
ph65_ogr_R3_B1	97.3	97.3	100.0	100.0	100.0	100.0	7.5	7.6
ph65_ogr_R3_B2	97.2	97.2	100.0	100.0	100.0	100.0	7.6	7.7
ph65_ogr_R3_B3	97.3	97.3	100.0	100.0	100.0	100.0	7.6	7.7
ph65_ogr_R3_B4	97.7	97.6	100.0	100.0	100.0	100.0	7.1	7.2
ph6_R1_B1	97.4	97.3	100.0	100.0	100.0	100.0	7.4	7.4
ph6_R1_B2	97.4	97.3	100.0	100.0	100.0	100.0	7.5	7.5
ph6_R1_B3	97.5	97.4	100.0	100.0	100.0	100.0	7.3	7.4
ph6_R1_B4	97.7	97.5	100.0	100.0	100.0	100.0	7.2	7.4
ph6_R2_B1	97.5	97.4	100.0	100.0	100.0	100.0	7.5	7.6
ph6_R2_B2	97.4	97.4	100.0	100.0	100.0	100.0	7.6	7.6
ph6_R2_B3	97.4	97.3	100.0	100.0	100.0	100.0	7.6	7.7
ph6_R2_B4	97.8	97.7	100.0	100.0	100.0	100.0	6.9	7.0
ph6_R3_B1	97.4	97.2	100.0	100.0	100.0	100.0	7.6	7.8
ph6_R3_B2	97.5	97.3	100.0	100.0	100.0	100.0	7.6	7.7
ph6_R3_B3	97.3	97.3	100.0	100.0	100.0	100.0	7.6	7.6
ph6_R3_B4	97.5	97.4	100.0	100.0	100.0	100.0	7.3	7.4
ph6_ogr_R1_B1	97.3	97.3	100.0	100.0	100.0	100.0	7.6	7.6
ph6_ogr_R1_B2	97.2	97.2	100.0	100.0	100.0	100.0	7.6	7.7
ph6_ogr_R1_B3	97.5	97.4	100.0	100.0	100.0	100.0	7.3	7.4
ph6_ogr_R1_B4	97.7	97.7	100.0	100.0	100.0	100.0	6.9	6.9
ph6_ogr_R2_B1	97.4	97.3	100.0	100.0	100.0	100.0	7.6	7.7
ph6_ogr_R2_B2	97.3	97.2	100.0	100.0	100.0	100.0	7.7	7.8
ph6_ogr_R2_B3	97.4	97.3	100.0	100.0	100.0	100.0	7.5	7.6
ph6_ogr_R2_B4	97.8	97.8	100.0	100.0	100.0	100.0	6.7	6.8
ph6_ogr_R3_B1	97.2	97.2	100.0	100.0	100.0	100.0	7.7	7.8
ph6_ogr_R3_B3	97.4	97.3	100.0	100.0	100.0	100.0	7.6	7.7
ph6_ogr_R3_B4	97.7	97.7	100.0	100.0	100.0	100.0	6.9	7.0
surface_R1_B1	97.2	97.2	100.0	100.0	100.0	100.0	7.8	7.8
surface_R1_B2	97.3	97.2	100.0	100.0	100.0	100.0	7.6	7.7
surface_R1_B3	97.7	97.7	100.0	100.0	100.0	100.0	6.9	7.0
surface_R1_B4	97.8	97.8	100.0	100.0	100.0	100.0	6.6	6.7
surface_R2_B1	97.3	97.2	100.0	100.0	100.0	100.0	7.8	7.9
surface_R2_B2	97.4	97.3	100.0	100.0	100.0	100.0	7.5	7.6
surface_R2_B3	97.6	97.6	100.0	100.0	100.0	100.0	7.0	7.0
surface_R2_B4	97.7	97.7	100.0	100.0	100.0	100.0	6.7	6.8
surface_R3_B1	97.2	97.1	100.0	100.0	100.0	100.0	7.9	7.9
surface_R3_B2	97.3	97.2	100.0	100.0	100.0	100.0	7.7	7.8
surface_R3_B4	97.7	97.5	100.0	100.0	100.0	100.0	7.0	7.2

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: idhist_bbm_table

Sort	Group	Column	Description	ID	Scale
\|\|	BBTools	Mean_reads	Average percent identity of aligned reads	`Mean_reads`	None
\|\|	BBTools	Mean_bases	Average percent identity of aligned bases	`Mean_bases`	None
\|\|	BBTools	Median_reads	Median percent identity of aligned reads	`Median_reads`	None
\|\|	BBTools	Median_bases	Median percent identity of aligned bases	`Median_bases`	None
\|\|	BBTools	Mode_reads	The most commonly occuring average value amongst aligned reads (i.e. the mode of the distribution)	`Mode_reads`	None
\|\|	BBTools	Mode_bases	The most commonly occuring average value amongst aligned bases (i.e. the mode of the distribution)	`Mode_bases`	None
\|\|	BBTools	STDev_reads	The standard deviation of the average percent identity distribution for aligned reads	`STDev_reads`	None
\|\|	BBTools	STDev_bases	The standard deviation of the average percent identity distribution for aligned bases	`STDev_bases`	None

Indel lengths

Indel length histogram (indelhist). The plots show the number of observed insertions and deletions, for each insertion and deletion length.

Match, substitution, deletion, and insertion rates

Histogram of match, substitution, deleletion, and insertion rates by read location (mhist).

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Read quality

Histogram of average read qualities (aqhist). Plot shows the number of reads at each quality score.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Errors-per-read

Errors-per-read histogram (ehist).

Read lengths

Read length histogram (lhist).

Insert sizes

Histogram of computed insert sizes, for paired reads (ihist). Plotted data has been cut off at 99% to prevent long tails; Complete data available in original source files.

The insert size is the length of the sequence between the sequencing adapters, which for most common insert sizes is longer than the sum of both read pairs. In some cases, the insert size is shorter than the length of the two read pairs combined, resulting in an insert size shorter than the sum of the length of the reads pairs.

Insert sizes summary table

Histogram of computed insert sizes, for paired reads (ihist). Plotted data has been cut off at 99% to prevent long tails; Complete data available in original source files.

Showing ⁸³/₈₃ rows and ⁴/₄ columns.

Sample Name	Mean	Median	STDev	PercentOfPairs
nontreated_R1	160.0	158.0	68.7	61.0
nontreated_R2	163.4	163.0	70.4	55.6
ph55_R1_B1	160.2	158.0	70.4	57.4
ph55_R1_B2	153.4	148.0	69.1	67.9
ph55_R1_B3	162.2	161.0	69.5	54.6
ph55_R1_B4	169.9	171.0	68.7	45.1
ph55_R2_B1	162.1	161.0	69.5	59.2
ph55_R2_B2	160.5	159.0	69.6	60.2
ph55_R2_B3	148.4	141.0	69.1	75.0
ph55_R2_B4	153.5	149.0	69.5	70.7
ph55_R3_B1	160.4	158.0	70.5	57.3
ph55_R3_B2	157.7	155.0	70.1	63.4
ph55_R3_B3	153.5	149.0	70.6	65.6
ph55_R3_B4	162.2	161.0	70.6	59.9
ph55_ogr_R1_B1	159.4	157.0	69.1	59.2
ph55_ogr_R1_B2	163.5	162.0	69.5	51.8
ph55_ogr_R1_B3	167.1	168.0	69.5	49.1
ph55_ogr_R1_B4	156.6	153.0	68.5	70.2
ph55_ogr_R2_B1	164.5	164.0	70.0	53.3
ph55_ogr_R2_B2	158.7	156.0	69.8	61.7
ph55_ogr_R2_B3	153.2	148.0	69.5	65.8
ph55_ogr_R2_B4	165.3	166.0	70.8	50.8
ph55_ogr_R3_B1	153.9	149.0	69.6	69.5
ph55_ogr_R3_B2	164.7	164.0	70.3	57.0
ph55_ogr_R3_B4	161.1	160.0	70.5	58.0
ph65_R1_B1	171.6	174.0	70.1	38.2
ph65_R1_B2	167.8	168.0	69.3	49.0
ph65_R1_B3	163.9	163.0	70.0	53.1
ph65_R1_B4	117.0	103.0	62.1	90.9
ph65_R2_B1	158.3	156.0	70.2	59.7
ph65_R2_B2	158.2	155.0	70.5	60.5
ph65_R2_B3	161.3	160.0	69.7	58.0
ph65_R2_B4	140.3	130.0	69.9	77.8
ph65_R3_B1	144.3	136.0	69.5	73.5
ph65_R3_B2	166.5	167.0	69.4	54.4
ph65_R3_B3	145.2	137.0	69.0	78.5
ph65_R3_B4	146.6	139.0	69.8	72.3
ph65_ogr_R1_B1	166.7	167.0	69.4	49.7
ph65_ogr_R1_B2	155.7	152.0	69.5	63.7
ph65_ogr_R1_B3	158.1	155.0	68.8	66.0
ph65_ogr_R1_B4	142.8	134.0	68.4	77.7
ph65_ogr_R2_B1	156.2	152.0	70.2	61.8
ph65_ogr_R2_B2	167.3	168.0	69.4	56.5
ph65_ogr_R2_B3	163.2	162.0	70.9	57.7
ph65_ogr_R2_B4	163.1	162.0	70.9	56.1
ph65_ogr_R3_B1	171.8	174.0	69.5	46.1
ph65_ogr_R3_B2	166.0	166.0	70.0	50.5
ph65_ogr_R3_B3	163.4	162.0	69.9	54.2
ph65_ogr_R3_B4	157.8	155.0	69.3	67.0
ph6_R1_B1	164.1	164.0	69.7	51.8
ph6_R1_B2	163.8	163.0	69.2	55.9
ph6_R1_B3	159.2	157.0	69.5	58.8
ph6_R1_B4	131.3	120.0	65.2	86.7
ph6_R2_B1	152.1	147.0	69.2	69.2
ph6_R2_B2	161.0	159.0	69.2	61.4
ph6_R2_B3	157.6	155.0	69.8	61.6
ph6_R2_B4	155.7	151.0	70.6	60.0
ph6_R3_B1	141.4	132.0	68.4	81.5
ph6_R3_B2	146.2	138.0	69.8	75.7
ph6_R3_B3	170.9	173.0	70.4	38.4
ph6_R3_B4	167.2	168.0	70.2	52.4
ph6_ogr_R1_B1	166.4	167.0	69.9	47.7
ph6_ogr_R1_B2	162.4	161.0	69.3	53.5
ph6_ogr_R1_B3	162.7	162.0	70.0	57.6
ph6_ogr_R1_B4	167.8	169.0	69.8	45.5
ph6_ogr_R2_B1	156.1	152.0	69.6	63.7
ph6_ogr_R2_B2	161.6	160.0	69.6	61.4
ph6_ogr_R2_B3	162.3	161.0	70.4	52.8
ph6_ogr_R2_B4	158.1	155.0	69.8	59.5
ph6_ogr_R3_B1	165.4	165.0	70.4	50.2
ph6_ogr_R3_B3	159.5	157.0	69.8	58.5
ph6_ogr_R3_B4	163.0	162.0	69.6	54.2
surface_R1_B1	173.8	177.0	69.9	46.2
surface_R1_B2	171.0	173.0	68.7	47.2
surface_R1_B3	167.3	168.0	69.6	53.3
surface_R1_B4	171.2	173.0	70.0	43.0
surface_R2_B1	158.4	156.0	69.8	60.8
surface_R2_B2	159.5	157.0	69.2	64.3
surface_R2_B3	166.4	167.0	70.5	47.7
surface_R2_B4	169.6	171.0	69.9	45.6
surface_R3_B1	167.1	168.0	70.4	51.3
surface_R3_B2	152.1	147.0	69.8	71.3
surface_R3_B4	143.6	135.0	70.0	77.4

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: ihist_bbm_table

Sort	Group	Column	Description	ID	Scale
\|\|	BBTools	Mean	Average insert length	`Mean`	None
\|\|	BBTools	Median	Median insert length	`Median`	None
\|\|	BBTools	STDev	Standard deviation of insert size length distribution	`STDev`	None
\|\|	BBTools	PercentOfPairs		`PercentOfPairs`	None

GC content

Read GC content histogram (gchist).

GC content summary table

Read GC content histogram (gchist).

Showing ⁸³/₈₃ rows and ⁴/₄ columns.

Sample Name	Mean	Median	Mode	STDev
nontreated_R1	56.8	53.6	52.4	7.1
nontreated_R2	56.3	53.4	52.4	6.8
ph55_R1_B1	57.0	53.6	52.4	7.3
ph55_R1_B2	57.7	54.2	52.4	7.6
ph55_R1_B3	56.3	53.4	52.4	6.8
ph55_R1_B4	55.4	53.0	52.4	6.1
ph55_R2_B1	56.9	53.6	52.4	7.2
ph55_R2_B2	57.0	53.6	52.4	7.2
ph55_R2_B3	59.0	55.6	52.4	8.2
ph55_R2_B4	58.4	54.8	52.4	8.1
ph55_R3_B1	56.9	53.6	52.4	7.2
ph55_R3_B2	57.7	54.2	52.4	7.7
ph55_R3_B3	57.5	54.0	52.4	7.5
ph55_R3_B4	56.7	53.6	52.4	7.1
ph55_ogr_R1_B1	56.8	53.6	52.4	7.1
ph55_ogr_R1_B2	56.5	53.4	52.4	7.0
ph55_ogr_R1_B3	56.0	53.2	52.4	6.5
ph55_ogr_R1_B4	57.6	54.2	52.4	7.5
ph55_ogr_R2_B1	56.2	53.4	52.4	6.8
ph55_ogr_R2_B2	57.2	53.8	52.4	7.4
ph55_ogr_R2_B3	58.1	54.4	52.4	7.9
ph55_ogr_R2_B4	56.2	53.2	52.4	6.8
ph55_ogr_R3_B1	58.3	54.6	52.4	8.0
ph55_ogr_R3_B2	56.7	53.6	52.4	7.2
ph55_ogr_R3_B4	56.6	53.4	52.4	7.1
ph65_R1_B1	55.4	53.2	52.4	6.1
ph65_R1_B2	55.9	53.2	52.4	6.5
ph65_R1_B3	56.6	53.4	52.4	7.0
ph65_R1_B4	64.8	65.4	52.4	9.3
ph65_R2_B1	57.2	53.8	52.4	7.5
ph65_R2_B2	57.3	53.8	52.4	7.5
ph65_R2_B3	57.0	53.6	52.4	7.3
ph65_R2_B4	61.0	59.6	52.4	9.4
ph65_R3_B1	59.2	56.2	52.4	8.4
ph65_R3_B2	56.6	53.6	52.4	6.9
ph65_R3_B3	59.8	57.0	52.4	8.5
ph65_R3_B4	59.4	57.2	52.4	9.1
ph65_ogr_R1_B1	55.7	53.2	52.4	6.3
ph65_ogr_R1_B2	57.7	54.2	52.4	7.7
ph65_ogr_R1_B3	57.7	54.2	52.4	7.6
ph65_ogr_R1_B4	59.7	57.8	52.4	8.7
ph65_ogr_R2_B1	57.2	53.8	52.4	7.4
ph65_ogr_R2_B2	56.2	53.4	52.4	6.7
ph65_ogr_R2_B3	56.8	53.6	52.4	7.2
ph65_ogr_R2_B4	56.9	53.8	52.4	7.5
ph65_ogr_R3_B1	55.7	53.2	52.4	6.3
ph65_ogr_R3_B2	56.2	53.4	52.4	6.7
ph65_ogr_R3_B3	56.4	53.4	52.4	6.8
ph65_ogr_R3_B4	57.6	54.6	52.4	7.6
ph6_R1_B1	56.6	53.6	52.4	7.0
ph6_R1_B2	56.7	53.6	52.4	7.1
ph6_R1_B3	56.8	53.6	52.4	7.1
ph6_R1_B4	62.4	61.6	52.4	9.2
ph6_R2_B1	58.1	54.4	52.4	7.8
ph6_R2_B2	56.9	53.6	52.4	7.1
ph6_R2_B3	57.1	53.8	52.4	7.4
ph6_R2_B4	57.5	54.6	52.4	8.1
ph6_R3_B1	60.1	57.6	52.0	8.5
ph6_R3_B2	59.0	55.8	52.4	8.2
ph6_R3_B3	55.1	53.0	52.4	5.8
ph6_R3_B4	56.2	53.4	52.4	6.8
ph6_ogr_R1_B1	55.9	53.2	52.4	6.5
ph6_ogr_R1_B2	56.2	53.4	52.4	6.7
ph6_ogr_R1_B3	56.5	53.4	52.4	7.0
ph6_ogr_R1_B4	56.2	53.4	52.4	6.9
ph6_ogr_R2_B1	57.7	54.0	52.4	7.7
ph6_ogr_R2_B2	57.0	53.6	52.4	7.3
ph6_ogr_R2_B3	56.7	53.6	52.4	7.1
ph6_ogr_R2_B4	56.9	53.6	52.4	7.2
ph6_ogr_R3_B1	56.4	53.4	52.4	6.8
ph6_ogr_R3_B3	57.3	53.8	52.4	7.4
ph6_ogr_R3_B4	56.5	53.4	52.4	6.9
surface_R1_B1	55.3	53.0	52.4	5.9
surface_R1_B2	56.0	53.4	52.4	6.5
surface_R1_B3	55.9	53.2	52.4	6.4
surface_R1_B4	55.3	53.0	52.4	6.0
surface_R2_B1	57.2	53.8	52.4	7.5
surface_R2_B2	57.7	54.2	52.4	7.8
surface_R2_B3	56.0	53.2	52.4	6.6
surface_R2_B4	55.8	53.2	52.4	6.4
surface_R3_B1	55.9	53.2	52.4	6.5
surface_R3_B2	58.6	55.0	52.4	8.0
surface_R3_B4	60.0	56.8	52.4	8.6

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: gchist_bbm_table

Sort	Group	Column	Description	ID	Scale
\|\|	BBTools	Mean	Average GC content	`Mean`	None
\|\|	BBTools	Median	Median GC content	`Median`	None
\|\|	BBTools	Mode	The most commonly occuring value of the GC content distribution	`Mode`	None
\|\|	BBTools	STDev	Standard deviation of average GC content	`STDev`	None

Base composition

Base composition histogram by position (bhist). The plot shows the percentage of G+C, A+T, and N bases for each position in the reads.

Relative composition

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

FastQC

Version: 0.12.1

FastQC is a quality control tool for high throughput sequence data, written by Simon Andrews at the Babraham Institute in Cambridge.

Sequence Counts

Sequence counts for each sample. Duplicate read counts are an estimate only.

This plot show the total number of reads, broken down into unique and duplicate if possible (only more recent versions of FastQC give duplicate info).

You can read more about duplicate calculation in the FastQC documentation. A small part has been copied here for convenience:

Only sequences which first appear in the first 100,000 sequences in each file are analysed. This should be enough to get a good impression for the duplication levels in the whole file. Each sequence is tracked to the end of the file to give a representative count of the overall duplication level.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Sequence Quality Histograms

The mean quality value across each base position in the read.

To enable multiple samples to be plotted on the same graph, only the mean quality scores are plotted (unlike the box plots seen in FastQC reports).

Taken from the FastQC help:

The y-axis on the graph shows the quality scores. The higher the score, the better the base call. The background of the graph divides the y axis into very good quality calls (green), calls of reasonable quality (orange), and calls of poor quality (red). The quality of calls on most platforms will degrade as the run progresses, so it is common to see base calls falling into the orange area towards the end of a read.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Per Sequence Quality Scores

The number of reads with average quality scores. Shows if a subset of reads has poor quality.

From the FastQC help:

The per sequence quality score report allows you to see if a subset of your sequences have universally low quality values. It is often the case that a subset of sequences will have universally poor quality, however these should represent only a small percentage of the total sequences.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Per Base Sequence Content

The proportion of each base position for which each of the four normal DNA bases has been called.

To enable multiple samples to be shown in a single plot, the base composition data is shown as a heatmap. The colours represent the balance between the four bases: an even distribution should give an even muddy brown colour. Hover over the plot to see the percentage of the four bases under the cursor.

To see the data as a line plot, as in the original FastQC graph, click on a sample track.

From the FastQC help:

Per Base Sequence Content plots out the proportion of each base position in a file for which each of the four normal DNA bases has been called.

In a random library you would expect that there would be little to no difference between the different bases of a sequence run, so the lines in this plot should run parallel with each other. The relative amount of each base should reflect the overall amount of these bases in your genome, but in any case they should not be hugely imbalanced from each other.

It's worth noting that some types of library will always produce biased sequence composition, normally at the start of the read. Libraries produced by priming using random hexamers (including nearly all RNA-Seq libraries) and those which were fragmented using transposases inherit an intrinsic bias in the positions at which reads start. This bias does not concern an absolute sequence, but instead provides enrichement of a number of different K-mers at the 5' end of the reads. Whilst this is a true technical bias, it isn't something which can be corrected by trimming and in most cases doesn't seem to adversely affect the downstream analysis.

Click a sample row to see a line plot for that dataset.

Rollover for sample name

Position: -

%T: -

%C: -

%A: -

%G: -

Per Sequence GC Content

The average GC content of reads. Normal random library typically have a roughly normal distribution of GC content.

From the FastQC help:

This module measures the GC content across the whole length of each sequence in a file and compares it to a modelled normal distribution of GC content.

In a normal random library you would expect to see a roughly normal distribution of GC content where the central peak corresponds to the overall GC content of the underlying genome. Since we don't know the the GC content of the genome the modal GC content is calculated from the observed data and used to build a reference distribution.

An unusually shaped distribution could indicate a contaminated library or some other kinds of biased subset. A normal distribution which is shifted indicates some systematic bias which is independent of base position. If there is a systematic bias which creates a shifted normal distribution then this won't be flagged as an error by the module since it doesn't know what your genome's GC content should be.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Per Base N Content

The percentage of base calls at each position for which an N was called.

From the FastQC help:

If a sequencer is unable to make a base call with sufficient confidence then it will normally substitute an N rather than a conventional base call. This graph shows the percentage of base calls at each position for which an N was called.

It's not unusual to see a very low proportion of Ns appearing in a sequence, especially nearer the end of a sequence. However, if this proportion rises above a few percent it suggests that the analysis pipeline was unable to interpret the data well enough to make valid base calls.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Sequence Length Distribution

All samples have sequences of a single length (250bp).

Sequence Duplication Levels

The relative level of duplication found for every sequence.

From the FastQC Help:

In a diverse library most sequences will occur only once in the final set. A low level of duplication may indicate a very high level of coverage of the target sequence, but a high level of duplication is more likely to indicate some kind of enrichment bias (eg PCR over amplification). This graph shows the degree of duplication for every sequence in a library: the relative number of sequences with different degrees of duplication.

The duplication detection requires an exact sequence match over the whole length of the sequence. Any reads over 75bp in length are truncated to 50bp for this analysis.

In a properly diverse library most sequences should fall into the far left of the plot in both the red and blue lines. A general level of enrichment, indicating broad oversequencing in the library will tend to flatten the lines, lowering the low end and generally raising other categories. More specific enrichments of subsets, or the presence of low complexity contaminants will tend to produce spikes towards the right of the plot.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Overrepresented sequences by sample

The total amount of overrepresented sequences found in each library.

FastQC calculates and lists overrepresented sequences in FastQ files. It would not be possible to show this for all samples in a MultiQC report, so instead this plot shows the number of sequences categorized as overrepresented.

Sometimes, a single sequence may account for a large number of reads in a dataset. To show this, the bars are split into two: the first shows the overrepresented reads that come from the single most common sequence. The second shows the total count from all remaining overrepresented sequences.

From the FastQC Help:

A normal high-throughput library will contain a diverse set of sequences, with no individual sequence making up a tiny fraction of the whole. Finding that a single sequence is very overrepresented in the set either means that it is highly biologically significant, or indicates that the library is contaminated, or not as diverse as you expected.

FastQC lists all the sequences which make up more than 0.1% of the total. To conserve memory only sequences which appear in the first 100,000 sequences are tracked to the end of the file. It is therefore possible that a sequence which is overrepresented but doesn't appear at the start of the file for some reason could be missed by this module.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Top overrepresented sequences

Top overrepresented sequences across all samples. The table shows 20 most overrepresented sequences across all samples, ranked by the number of samples they occur in.

Showing ²⁰/₂₀ rows and ³/₃ columns.

Overrepresented sequence	Samples	Occurrences	% of all reads
GTTCTACATCTGCTCCCTTCCCTTTTGGCTGCAGTACGTCCTCCAGCATG	166	17939525	0.9045%
GTCTTATACTTGGGTTTGTCTGGTCAACCACCGCGGTCTCCGTCGTCAGG	166	13875976	0.6996%
GCCCTGGGGACGTCGTCGCGGGTGGCTAAGCGCACCGTGGGCTTGTACTC	166	12305410	0.6204%
ATGTAGAACAGGTCTGCCACTGTCAGGTTGCACAAGTACACTCCCAACTC	166	12261649	0.6182%
ACCCTATTCAAGCCTGGCAGCGAGCTATCAATTACTACAGATTTCTCGTG	166	10780616	0.5435%
CTTCTGACCAGCAGCAACACATGATATGGCAGGAAGCACGCGAGGAAAAT	166	10695012	0.5392%
GAATAGGGTAGTGCTCGAAGCAGACCCTGTGCTGATTCTCGTCCTCGATC	166	10013724	0.5049%
GAGCTACATCTTCTGCCTGGTATTCGCCGACTACAAGGACGATGATGACG	166	9148780	0.4613%
GGTCAGAAGCGTGTGGGAGGCATCTTGTGACTTCGCCAAGGGAGTCTTTA	166	8156703	0.4112%
GTGCTGAGCACAAGTCTCTGAATTTGGTCTTTGCGAGATTTCTGAGTACC	166	8144354	0.4106%
ATCCACCAGACCCTCGCTCCCGTGGTTTACGTTACGGTACTTGTCGTAGG	166	7476585	0.3770%
AAGCAGACCCTGTGCTGATTCTCGTCCTCGATCACTTCCTCGTGCATCAA	166	7291043	0.3676%
GTATATATTCTCATAAAGAAGAATCCCGCACACTTGGCAGCTCAGGTCAC	166	7566169	0.3815%
AGCGTGGACCGCTACCTGGCCGTAGCCCATCCTTTCCGATTCCACCAGTT	166	7262512	0.3662%
GTCCTGGATTTTCCTCCACATCACCAGCTTGTTTCAGTAGACTAAAATTA	166	6923353	0.3491%
CTACAAGGACGATGATGACGCCAGCATCGATATGGGGAACATCACTGCCG	166	6670813	0.3363%
CCTCTGGGGCACCCAGCGGATATGCTTCGCGTGCCCTGCCGGTCCTTGAA	166	7196386	0.3628%
CCATGAAGACGATCATCGCCCTGAGCTACATCTTCTGCCTGGTATTCGCC	166	6755794	0.3406%
GATTATACCGCAACTACACGCCACCCCGTCAGATCCGGCCACCATGAAGA	166	6619857	0.3338%
GCGTTAAAGACTCCCTTGGCGAAGTCACAAGATGCCTCCCACACGCTTCT	166	6476300	0.3265%

Uncheck the tick box to hide columns. Click and drag the handle on the left to change order. Table ID: fastqc_top_overrepresented_sequences_table

Sort	Group	Column	Description	ID	Scale
\|\|	FastQC	Samples	Number of samples where this sequence is overrepresented	`samples`	None
\|\|	FastQC	Occurrences	Total number of occurrences of the sequence (among the samples where the sequence is overrepresented)	`total_count`	None
\|\|	FastQC	% of all reads	Total number of occurrences as the percentage of all reads (among samples where the sequence is overrepresented)	`total_percent`	None

Adapter Content

The cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position.

Note that only samples with ≥ 0.1% adapter contamination are shown.

There may be several lines per sample, as one is shown for each adapter detected in the file.

From the FastQC Help:

The plot shows a cumulative percentage count of the proportion of your library which has seen each of the adapter sequences at each position. Once a sequence has been seen in a read it is counted as being present right through to the end of the read so the percentages you see will only increase as the read length goes on.

Flat image plot. Toolbox functions such as highlighting / hiding samples will not work (see the docs).

Status Checks

Status for each FastQC section showing whether results seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

FastQC assigns a status for each section of the report. These give a quick evaluation of whether the results of the analysis seem entirely normal (green), slightly abnormal (orange) or very unusual (red).

It is important to stress that although the analysis results appear to give a pass/fail result, these evaluations must be taken in the context of what you expect from your library. A 'normal' sample as far as FastQC is concerned is random and diverse. Some experiments may be expected to produce libraries which are biased in particular ways. You should treat the summary evaluations therefore as pointers to where you should concentrate your attention and understand why your library may not look random and diverse.

Specific guidance on how to interpret the output of each module can be found in the relevant report section, or in the FastQC help.

In this heatmap, we summarise all of these into a single heatmap for a quick overview. Note that not all FastQC sections have plots in MultiQC reports, but all status checks are shown in this heatmap.

Min:

Max:

Software Versions

Software Versions lists versions of software tools extracted from file contents.

Software	Version
FastQC	`0.12.1`

Toggle navigation v1.18 (56ae09e)

MultiQC Toolbox

Apply Highlight Samples

Apply Rename Samples

Apply Show / Hide Samples

Export Plots

Choose Plots

Save Settings

Load Settings

Tool Citations

About MultiQC

General Statistics

General Statistics: Columns

Variant processing (accepted variants)

Variant processing (rejected variants)

Variant processing stats

GATK

GATK ASM counts Help

GATK ASM counts: Columns

Read counts Help

Base calls Help

BBTools

BBDuk filtering statistics summary table

Stats Bbm Table: Columns

Identity histogram

Identity histogram summary table

Idhist Bbm Table: Columns

Indel lengths

Match, substitution, deletion, and insertion rates

Read quality

Errors-per-read

Read lengths

Insert sizes Help

Insert sizes summary table Help

Ihist Bbm Table: Columns

GC content

GC content summary table

Gchist Bbm Table: Columns

Base composition Help

FastQC

Sequence Counts Help

Sequence Quality Histograms Help

Per Sequence Quality Scores Help

Per Base Sequence Content Help

Rollover for sample name

Per Sequence GC Content Help

Per Base N Content Help

Sequence Length Distribution

Sequence Duplication Levels Help

Overrepresented sequences by sample Help

Top overrepresented sequences

FastQC: Top overrepresented sequences: Columns

Adapter Content Help

Status Checks Help

Software Versions

v1.18 (56ae09e)

Highlight Samples

Rename Samples

Show / Hide Samples

GATK ASM counts

Read counts

Base calls

Insert sizes

Insert sizes summary table

Base composition

Sequence Counts

Sequence Quality Histograms

Per Sequence Quality Scores

Per Base Sequence Content

Per Sequence GC Content

Per Base N Content

Sequence Duplication Levels

Overrepresented sequences by sample

Adapter Content

Status Checks